Detailed Analysis of the Scope and Claims of United States Patent 10,208,307
Introduction
United States Patent 10,208,307, titled "Transthyretin (TTR) iRNA compositions and methods of use thereof for treating or preventing TTR-associated diseases," is a crucial patent held by Alnylam Pharmaceuticals Inc. for their siRNA drug Amvuttra. This patent is part of a broader patent strategy that protects the active ingredient, delivery methods, and therapeutic uses of Amvuttra.
Patent Overview
Patent Title and Number
The patent in question is US10208307B2, which falls under the category of "Transthyretin (TTR) iRNA compositions and methods of use thereof for treating or preventing TTR-associated diseases"[2][4].
Patent Owner
The patent is owned by Alnylam Pharmaceuticals Inc., a leading company in the development of RNA interference (RNAi) therapeutics[2].
Claims Analysis
Independent Claim 1
The independent claim 1 of US10208307B2 is particularly significant as it defines the core composition of the siRNA agent:
-
Sense Strand and Antisense Strand: The claim specifies a double-stranded ribonucleic acid (RNAi) agent that inhibits the expression of transthyretin (TTR) in a cell. The sense strand differs by no more than 4 modified nucleotides from the sequence "UGGGAUUUCAUGUAACCAAGA" (SEQ ID NO: 10), and the antisense strand differs by no more than 4 modified nucleotides from the sequence "UCUUGGUUACAUGAAAUCCCAUC" (SEQ ID NO: 7)[1].
-
Nucleotide Modifications: The claim details that the nucleotides can be modified with 2′-O-methyl (2′-OMe) A, C, G, and U, and 2′-fluoro A, C, G, and U. Additionally, it specifies the use of phosphorothioate linkages[1].
-
Ligand Structure: The patent also describes a ligand structure conjugated to the sense strand, specifically "one or more GalNAc derivatives attached through a bivalent or trivalent branched linker"[1].
Dependent Claims
Dependent claims further elaborate on the composition, method of use, and specific modifications of the siRNA agent. These claims provide additional protection by detailing various aspects such as the preparation methods, dosage forms, and specific therapeutic applications.
Patent Scope and Protection
Patent Scope Metrics
The scope of the patent can be measured using metrics such as independent claim length and independent claim count. Narrower claims, as seen in this patent, are associated with a higher probability of grant and a shorter examination process. This indicates that the patent office has carefully evaluated and narrowed the claims to ensure clarity and specificity[3].
Patent Protection Strategy
Alnylam Pharmaceuticals has implemented a comprehensive patent protection strategy for Amvuttra. This includes filing multiple patents to protect the core components, delivery agents, sequences, and their modifications. The strategy involves filing divisional and continuation applications to expand the scope and intensity of protection, as well as to extend the protection period through priority claims[4].
Therapeutic Use and Disease Target
Transthyretin (TTR) Associated Diseases
The patent focuses on the treatment or prevention of TTR-associated diseases, such as hereditary transthyretin amyloidosis (hATTR amyloidosis). The siRNA agent is designed to inhibit the expression of TTR, thereby reducing the accumulation of amyloid fibrils that cause these diseases[1].
Patent Expiration and Generic Availability
Patent Expiration
The patents protecting Amvuttra, including US10208307B2, are set to expire in July 2036. This means that the exclusive rights to manufacture and market Amvuttra will remain with Alnylam Pharmaceuticals until then[2].
Generic Availability
As of now, there is no therapeutically equivalent generic version of Amvuttra available in the United States. The patent and exclusivity rights held by Alnylam Pharmaceuticals ensure that no generic version can be launched until the patents expire[5].
Practical Implications for Patent Research and Analysis
Conducting Patent Research
To conduct patent research on siRNA drugs like Amvuttra, one must use specialized tools such as Patsnap Analytics and Synapse. This involves drawing or importing the ligand structure, performing substructure searches, and analyzing the claims and specifications of relevant patents[4].
Analyzing Patent Layout
Analyzing the patent layout in different jurisdictions, such as the United States and China, is crucial. This involves sorting patents by application date, reviewing claims and specifications, and classifying the main protection themes and legal status of each patent[4].
Key Takeaways
- Specific Claims: US10208307B2 specifically protects the siRNA agent composition, including the sense and antisense strands and their modifications.
- Comprehensive Protection: Alnylam Pharmaceuticals has a robust patent protection strategy that includes multiple patents for delivery agents, sequences, and therapeutic uses.
- Therapeutic Use: The patent targets TTR-associated diseases by inhibiting TTR expression.
- Patent Expiration: The patents expire in July 2036, ensuring exclusive rights for Alnylam until then.
- Generic Availability: No generic version of Amvuttra is currently available due to the ongoing patent protection.
FAQs
Q: What is the main focus of US Patent 10,208,307?
A: The main focus of US Patent 10,208,307 is the protection of siRNA compositions and methods for treating or preventing transthyretin (TTR) associated diseases.
Q: What are the key components of the siRNA agent described in the patent?
A: The siRNA agent includes a sense strand and an antisense strand with specific nucleotide sequences and modifications, along with a ligand structure conjugated to the sense strand.
Q: How does Alnylam Pharmaceuticals protect its siRNA drug Amvuttra?
A: Alnylam protects Amvuttra through a comprehensive patent strategy involving multiple patents for delivery agents, sequences, and therapeutic uses, as well as divisional and continuation applications.
Q: When are the patents protecting Amvuttra set to expire?
A: The patents protecting Amvuttra are set to expire in July 2036.
Q: Is a generic version of Amvuttra available?
A: No, there is currently no therapeutically equivalent generic version of Amvuttra available in the United States.
Sources
- Synapse Patsnap Blog: "siRNA Drug Amvuttra Patent Research and Practical Operation Guide"
- Pharsight: "Amvuttra patent expiration"
- Hoover Institution: "Patent Claims and Patent Scope"
- Synapse Patsnap Blog: "siRNA Drug Amvuttra Patent Research and Practical Operation Guide (3)"
- Drugs.com: "Generic Amvuttra Availability"
